View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10125_low_17 (Length: 401)
Name: NF10125_low_17
Description: NF10125
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10125_low_17 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 131; Significance: 7e-68; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 131; E-Value: 7e-68
Query Start/End: Original strand, 255 - 385
Target Start/End: Complemental strand, 35339932 - 35339802
Alignment:
| Q |
255 |
gtaacttttaatgtttttgggtggttttgttatacttggtcttgatccattggaggctaacggaggtaccctccttcaacttcttgacgccagaagatgc |
354 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35339932 |
gtaacttttaatgtttttgggtggttttgttatacttggtcttgatccattggaggctaacggaggtaccctccttcaacttcttgacgccagaagatgc |
35339833 |
T |
 |
| Q |
355 |
aactgtcttggtcttgtctaggactttgtct |
385 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
35339832 |
aactgtcttggtcttgtctaggactttgtct |
35339802 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 128; E-Value: 5e-66
Query Start/End: Original strand, 49 - 193
Target Start/End: Complemental strand, 35340140 - 35339994
Alignment:
| Q |
49 |
tactcgaacggaagata--atacaaccatatctcctatacagagtaaagagctatgtccatcgaaactcacctcacacattaagaataaatgaattgaaa |
146 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||| ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35340140 |
tactcgaacggaagatacaatacaaccatatctcctgtacagagtaaagagctatgtccatcaaaactcacctcacacattaagaataaatgaattgaaa |
35340041 |
T |
 |
| Q |
147 |
gatcaaattaaagacatactggtaggtgatagtagtaatcaaccagt |
193 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35340040 |
gatcaaattaaagacatactggtaggtgatagtagtaatcaaccagt |
35339994 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University