View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10125_low_19 (Length: 362)

Name: NF10125_low_19
Description: NF10125
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10125_low_19
NF10125_low_19
[»] chr7 (1 HSPs)
chr7 (1-111)||(37430109-37430219)


Alignment Details
Target: chr7 (Bit Score: 99; Significance: 8e-49; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 99; E-Value: 8e-49
Query Start/End: Original strand, 1 - 111
Target Start/End: Original strand, 37430109 - 37430219
Alignment:
1 acggctcagttgcagttatacgaccggatatagggagcccttcagcaggattttgtttcatccactaccataatatatgatcattcaaatcacccactta 100  Q
    ||||||| |||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |||||||    
37430109 acggctcggttgcagttatacgaccggatatagggagcccttcagcgggattttgtttcatccactaccataatatatgatcattcaaatcaaccactta 37430208  T
101 cttaaaacata 111  Q
    |||||||||||    
37430209 cttaaaacata 37430219  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University