View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10125_low_19 (Length: 362)
Name: NF10125_low_19
Description: NF10125
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF10125_low_19 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 99; Significance: 8e-49; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 99; E-Value: 8e-49
Query Start/End: Original strand, 1 - 111
Target Start/End: Original strand, 37430109 - 37430219
Alignment:
Q |
1 |
acggctcagttgcagttatacgaccggatatagggagcccttcagcaggattttgtttcatccactaccataatatatgatcattcaaatcacccactta |
100 |
Q |
|
|
||||||| |||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
T |
37430109 |
acggctcggttgcagttatacgaccggatatagggagcccttcagcgggattttgtttcatccactaccataatatatgatcattcaaatcaaccactta |
37430208 |
T |
 |
Q |
101 |
cttaaaacata |
111 |
Q |
|
|
||||||||||| |
|
|
T |
37430209 |
cttaaaacata |
37430219 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University