View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10125_low_27 (Length: 298)
Name: NF10125_low_27
Description: NF10125
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10125_low_27 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 267; Significance: 1e-149; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 267; E-Value: 1e-149
Query Start/End: Original strand, 1 - 275
Target Start/End: Original strand, 30769202 - 30769476
Alignment:
| Q |
1 |
atattggcaaataaagcagacattataagtttccaatgttattttgttccttttgcattgctttaaggttgtgtatattgataggacttatgttgaacac |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30769202 |
atattggcaaataaagcagacattataagtttccaatgttattttgttccttttgcattgctttaaggttgtgtatattgataggacttatgttgaacac |
30769301 |
T |
 |
| Q |
101 |
gttagttgttcgacttatgttctaacacattagttttttgagtgttgaaacactcttatcaaatcaaatttacttaagtgagagcatagtttggttattt |
200 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30769302 |
attagttgttcgacttatgttctaatacattagttttttgagtgttgaaacactcttatcaaatcaaatttacttaagtgagagcatagtttggttattt |
30769401 |
T |
 |
| Q |
201 |
gtacgatgagtaaattcactagtcttgtaatttcttactttggtttgctgaaatgaatgcatatataggatgcaa |
275 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30769402 |
gtacgatgagtaaattcactagtcttgtaatttcttactttggtttgctgaaatgaatgcatatataggatgcaa |
30769476 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 4 - 61
Target Start/End: Original strand, 30773056 - 30773113
Alignment:
| Q |
4 |
ttggcaaataaagcagacattataagtttccaatgttattttgttccttttgcattgc |
61 |
Q |
| |
|
||||||||||||||| || | || ||||| || || |||||||||||||||||||||| |
|
|
| T |
30773056 |
ttggcaaataaagcaaacttgattagtttgcagtgctattttgttccttttgcattgc |
30773113 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University