View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10125_low_33 (Length: 273)
Name: NF10125_low_33
Description: NF10125
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10125_low_33 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 233; Significance: 1e-129; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 233; E-Value: 1e-129
Query Start/End: Original strand, 19 - 259
Target Start/End: Original strand, 5846453 - 5846693
Alignment:
| Q |
19 |
gattcgaccaataattcatgcataaactttacacgatgcatccttacagctggaaaaatggtgacatgtaataatgaacaagagaattgtggttcctagc |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
5846453 |
gattcgaccaataattcatgcataaactttacacgatgcatccttacagctggaaaaatggtgacatgtaataatgtacaagagaattgtggttcctagc |
5846552 |
T |
 |
| Q |
119 |
atatactactacaaatcttttaatatctatcgtaaacttttgggtccccttaattatccatcttctcttttgatttggaaaaaatgtacgagtctttttc |
218 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
5846553 |
atatactactacaaatcttttaatatctatcgtaaacttttgggtccccttaattatccatcttctcttttgatttggaaaaaatgtacgagtctatttc |
5846652 |
T |
 |
| Q |
219 |
ttatgatatctatcagccacaatctttagctagcttcactc |
259 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5846653 |
ttatgatatctatcagccacaatctttagctagcttcactc |
5846693 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University