View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10125_low_37 (Length: 264)

Name: NF10125_low_37
Description: NF10125
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10125_low_37
NF10125_low_37
[»] chr4 (1 HSPs)
chr4 (1-247)||(25813938-25814184)


Alignment Details
Target: chr4 (Bit Score: 235; Significance: 1e-130; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 235; E-Value: 1e-130
Query Start/End: Original strand, 1 - 247
Target Start/End: Original strand, 25813938 - 25814184
Alignment:
1 ctgagttgtggtttcaaaagaaactctacaaatgcagacatatgattcgtgaggctataaattctgatggatactgggtactaagaagatcgtggccaaa 100  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |||||||||||||||||||||||    
25813938 ctgagttgtggtttcaaaagaaactctacaaatgcagacatatgattcgtgaggctattaattctgatggatactgagtactaagaagatcgtggccaaa 25814037  T
101 taatttggtatactcaaaggtatgtgttgatcaatttgaagcatgcaaagaaccacaactaaagaaaggtctttggtgggcgaattcagatgaggactac 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||    
25814038 taatttggtatactcaaaggtatgtgttgatcaatttgaagcatgcaaagaacaacaactaaagaaaggtctttggtgggcgaattcagatgaggactac 25814137  T
201 gaattcgacacttgcattaattgtcgtcttgacttggaagtggattg 247  Q
    |||||||||||||||||||||||||||||||||||||||||||||||    
25814138 gaattcgacacttgcattaattgtcgtcttgacttggaagtggattg 25814184  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University