View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10125_low_45 (Length: 251)
Name: NF10125_low_45
Description: NF10125
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10125_low_45 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 179; Significance: 1e-96; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 179; E-Value: 1e-96
Query Start/End: Original strand, 1 - 215
Target Start/End: Complemental strand, 21922879 - 21922665
Alignment:
| Q |
1 |
ttagagattagaattgatcttgcattatcttcgagacatcgagatttttgaaaggcaatagatgaagccataattgaaataaaaggagtttatagttgat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |||||| ||||||||||||||||| |
|
|
| T |
21922879 |
ttagagattagaattgatcttgcattatcttcgacacatcgagatttttgaaaggcaatagatgaagccataattaaaataagaggagtttatagttgat |
21922780 |
T |
 |
| Q |
101 |
caaggaaagatatcaaggatcaacttatgaaacttaattccaacacaacttgtttattgtttcatttgtttgtttcaccactctctcataatcaatgcaa |
200 |
Q |
| |
|
|||| |||||||| | |||||||||| |||||| ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21922779 |
caagaaaagatatgagggatcaacttgtgaaacctaattccaatacaacttgtttattgtttcatttgtttgtttcaccactctctcataatcaatgcaa |
21922680 |
T |
 |
| Q |
201 |
ctatcaaccatctac |
215 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
21922679 |
ctatcaaccatctac |
21922665 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 31; Significance: 0.00000002; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 70 - 108
Target Start/End: Complemental strand, 14922082 - 14922044
Alignment:
| Q |
70 |
ataattgaaataaaaggagtttatagttgatcaaggaaa |
108 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
14922082 |
ataattgaaatatgaggagtttatagttgatcaaggaaa |
14922044 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 214 - 242
Target Start/End: Original strand, 19195684 - 19195712
Alignment:
| Q |
214 |
acatccattattattgatttatttcttct |
242 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
19195684 |
acatccattattattgatttatttcttct |
19195712 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 70 - 111
Target Start/End: Complemental strand, 26653229 - 26653188
Alignment:
| Q |
70 |
ataattgaaataaaaggagtttatagttgatcaaggaaagat |
111 |
Q |
| |
|
||||||| |||||||||| |||| |||||||||||||||||| |
|
|
| T |
26653229 |
ataattggaataaaaggaatttaaagttgatcaaggaaagat |
26653188 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 214 - 242
Target Start/End: Complemental strand, 56687 - 56659
Alignment:
| Q |
214 |
acatccattattattgatttatttcttct |
242 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
56687 |
acatccattattattgatttatttcttct |
56659 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University