View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10125_low_46 (Length: 251)
Name: NF10125_low_46
Description: NF10125
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF10125_low_46 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 212; Significance: 1e-116; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 19 - 242
Target Start/End: Original strand, 34074972 - 34075195
Alignment:
Q |
19 |
gcagatgattccaccatagcccgaagttcctgggtatatttattactgatcagtatatttaagttttacaaattttatgagtacttatgcagaaatggta |
118 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
34074972 |
gcagatgattccaccatagcccgaagttcctgggtatatttattactgatcagtatatttaagttttacaaattttatgagtacttatgcagaaatggta |
34075071 |
T |
 |
Q |
119 |
cacaagagaaaatcttactgcacttaaacatttaaaatattgctcataatgtttatttaagatgcaaaacatgttttgcattttgaaagcataaccatgt |
218 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
T |
34075072 |
cacaagagaaaatcttactgcacttaaacatttaaaatattactcataatgtttatttaagatgcaaaacatgttttgtattttgaaagcataaccatgt |
34075171 |
T |
 |
Q |
219 |
gatcataacatgcctgccctttgc |
242 |
Q |
|
|
|||||||| ||||||||||||||| |
|
|
T |
34075172 |
gatcataatatgcctgccctttgc |
34075195 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University