View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10125_low_49 (Length: 248)
Name: NF10125_low_49
Description: NF10125
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10125_low_49 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 190; Significance: 1e-103; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 17 - 248
Target Start/End: Original strand, 30768819 - 30769054
Alignment:
| Q |
17 |
aaatggttattagtaaccacttgatgcttctttgtataatattatcattctaacctttgttgttttctaatatgaataggctcttgttctattaatttat |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30768819 |
aaatggttattagtaaccacttgatgcttctttgtataatattatcattctaacctttgttgttttctaatatgaataggctcttgttctattaatttat |
30768918 |
T |
 |
| Q |
117 |
ta----tgattatactgagaggtaaccttgaaagcttatttcgattaaatacatcactgatttgtgtattannnnnnnattcttatgtagtatatcctcg |
212 |
Q |
| |
|
|| |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
30768919 |
tatgattgattatactgagaggtaacattgaaagcttatttcgattaaatacatcactgatttgtgtattatttttttattcttatgtagtatatcctcg |
30769018 |
T |
 |
| Q |
213 |
atacgaagatggtatttcctgctcctaagaagcccc |
248 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||| |
|
|
| T |
30769019 |
atacgaagatggtatttcctgctcttaagaagcccc |
30769054 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University