View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10125_low_51 (Length: 247)
Name: NF10125_low_51
Description: NF10125
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10125_low_51 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 210; Significance: 1e-115; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 16 - 237
Target Start/End: Complemental strand, 43372164 - 43371943
Alignment:
| Q |
16 |
cacatcctgcctgttaagataatcttcaagccactcaattgtgtcaagatcaaggtgatttgtaggctcatctaacaacaacaaatccggttcctgaaat |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
43372164 |
cacatcctgcctgttaagataatcttcaagccactcaattgtgtcaagatcaaggtgatttgtaggctcatctaacaacagtaaatccggttcctgaaat |
43372065 |
T |
 |
| Q |
116 |
tgaaaacaaagtgtcattcgtatcaccaacactttcacattcaaactagcaaaacaacatcaacgattcatcaatatacacattccaaagtaacattggt |
215 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43372064 |
tgaaaacaaagtgtcattcgtatcaccaacactttcacattcaaactagcataacaacatcaacgattcatcaatatacacattccaaagtaacattggt |
43371965 |
T |
 |
| Q |
216 |
tatatcagcactacatcctatg |
237 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
43371964 |
tatatcagcactacatcctatg |
43371943 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University