View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10125_low_55 (Length: 236)
Name: NF10125_low_55
Description: NF10125
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10125_low_55 |
 | |
|
| [»] chr4 (3 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 60; Significance: 1e-25; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 165 - 236
Target Start/End: Complemental strand, 17444715 - 17444644
Alignment:
| Q |
165 |
agccctaatttgggttgatgccgtttattttcttatattatattttgctattaaataaaacagattatactt |
236 |
Q |
| |
|
||||||||||||| ||| ||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
17444715 |
agccctaatttggcttggtgccgtttattttcttatattatattttgctattaaataaaacagatgatactt |
17444644 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 13 - 63
Target Start/End: Complemental strand, 17445872 - 17445822
Alignment:
| Q |
13 |
ctattttccttggcggcagaggatgtggtgcttgttatcaggtgcatgcaa |
63 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
17445872 |
ctattttccttggcgggagaggatgtggtgcttgttatcaggtgcatgcaa |
17445822 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 13 - 65
Target Start/End: Complemental strand, 9630608 - 9630556
Alignment:
| Q |
13 |
ctattttccttggcggcagaggatgtggtgcttgttatcaggtgcatgcaact |
65 |
Q |
| |
|
|||||||||||| || ||||||||||||||||||||||||||||||| |||| |
|
|
| T |
9630608 |
ctattttccttgagggtagaggatgtggtgcttgttatcaggtgcatgtaact |
9630556 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University