View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10125_low_57 (Length: 233)
Name: NF10125_low_57
Description: NF10125
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10125_low_57 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 195; Significance: 1e-106; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 17 - 219
Target Start/End: Original strand, 40113589 - 40113791
Alignment:
| Q |
17 |
actatcgagctggaatacatacatagtagtactagaaaagaagcttcactttgatcaagaggacaaaggcgaagaaaagggtcaactgaaaatggaagca |
116 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
40113589 |
actatcgagctggaatacatacatagcagtactagaaaagaagcttcactttgatcaagaggacaaagacgaagaaaagggtcaactgaaaatggaagca |
40113688 |
T |
 |
| Q |
117 |
gtgaagggttgtcataaggaattagaagcaaaagcacaagtagttgcaaatgatgttgtcacagaaactgaactaaccaaaatccgtcttgtgagagcct |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40113689 |
gtgaagggttgtcataaggaattagaagcaaaagcacaagtagttgcaaatgatgttgtcacagaaactgaactaaccaaaatccgtcttgtgagagcct |
40113788 |
T |
 |
| Q |
217 |
ttg |
219 |
Q |
| |
|
||| |
|
|
| T |
40113789 |
ttg |
40113791 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 161 - 219
Target Start/End: Original strand, 40120994 - 40121052
Alignment:
| Q |
161 |
tgcaaatgatgttgtcacagaaactgaactaaccaaaatccgtcttgtgagagcctttg |
219 |
Q |
| |
|
||||||||||| ||| ||||||||||||||||||||||||||||||||| || |||||| |
|
|
| T |
40120994 |
tgcaaatgatgctgttacagaaactgaactaaccaaaatccgtcttgtgcgaccctttg |
40121052 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University