View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10125_low_60 (Length: 231)
Name: NF10125_low_60
Description: NF10125
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10125_low_60 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 180; Significance: 2e-97; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 180; E-Value: 2e-97
Query Start/End: Original strand, 1 - 208
Target Start/End: Original strand, 34563522 - 34563729
Alignment:
| Q |
1 |
gtccaccgggacttaatctttgaagctcgtcacgttttccaccttcttcttttgcaaatggttgtatggaattccaattccaatgagaagttgctaacat |
100 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||||| || ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34563522 |
gtccaccgggacttaatctttgtagctcgtcacgttttccaccttcttcttctggaaatggttgtatggaattccaattccaatgagaagttgctaacat |
34563621 |
T |
|
| Q |
101 |
gtgatgatcacttaccattgttgggttcaaatgtcgtgtctcacctccaccacttagaaccaacactaacaaaatgcaacccaaaattctcgtttctttg |
200 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||| ||||| |||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
34563622 |
gtgatgatcacttaccattgttgggttcagatgtcgtgtctcacctctaccacatagaaccaacactaacaaaatgcaactcaaaattctcgtttctttg |
34563721 |
T |
|
| Q |
201 |
gtcattct |
208 |
Q |
| |
|
|||||||| |
|
|
| T |
34563722 |
gtcattct |
34563729 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University