View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10125_low_60 (Length: 231)

Name: NF10125_low_60
Description: NF10125
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10125_low_60
NF10125_low_60
[»] chr4 (1 HSPs)
chr4 (1-208)||(34563522-34563729)


Alignment Details
Target: chr4 (Bit Score: 180; Significance: 2e-97; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 180; E-Value: 2e-97
Query Start/End: Original strand, 1 - 208
Target Start/End: Original strand, 34563522 - 34563729
Alignment:
1 gtccaccgggacttaatctttgaagctcgtcacgttttccaccttcttcttttgcaaatggttgtatggaattccaattccaatgagaagttgctaacat 100  Q
    |||||||||||||||||||||| |||||||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||||||||||||||    
34563522 gtccaccgggacttaatctttgtagctcgtcacgttttccaccttcttcttctggaaatggttgtatggaattccaattccaatgagaagttgctaacat 34563621  T
101 gtgatgatcacttaccattgttgggttcaaatgtcgtgtctcacctccaccacttagaaccaacactaacaaaatgcaacccaaaattctcgtttctttg 200  Q
    ||||||||||||||||||||||||||||| ||||||||||||||||| ||||| |||||||||||||||||||||||||| |||||||||||||||||||    
34563622 gtgatgatcacttaccattgttgggttcagatgtcgtgtctcacctctaccacatagaaccaacactaacaaaatgcaactcaaaattctcgtttctttg 34563721  T
201 gtcattct 208  Q
    ||||||||    
34563722 gtcattct 34563729  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University