View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10125_low_66 (Length: 202)
Name: NF10125_low_66
Description: NF10125
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10125_low_66 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 170; Significance: 2e-91; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 170; E-Value: 2e-91
Query Start/End: Original strand, 13 - 186
Target Start/End: Original strand, 51961448 - 51961621
Alignment:
| Q |
13 |
gcatagggatgaagggtgttctgttcttgccaaaatggaagggtggaagcctctaactttggcggttgaaagaaaagtgccttgtctttgatttgttgaa |
112 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51961448 |
gcatggggatgaagggtgttctgttcttgccaaaatggaagggtggaagcctctaactttggcggttgaaagaaaagtgccttgtctttgatttgttgaa |
51961547 |
T |
|
| Q |
113 |
taatgttgactttgagcttgattgcaaaatattggtggatgcttttcacaacccaaagatgatgtctcagagtt |
186 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51961548 |
taatgttgactttgagcttgattgcaaaatattggtggatgcttttcacaacccaaagatgatgtctcagagtt |
51961621 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University