View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10126_high_10 (Length: 210)
Name: NF10126_high_10
Description: NF10126
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10126_high_10 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 178; Significance: 3e-96; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 178; E-Value: 3e-96
Query Start/End: Original strand, 14 - 195
Target Start/End: Complemental strand, 32340849 - 32340668
Alignment:
| Q |
14 |
agatgaatatagatattacaatgctggaaatataaggtttgagataactgaagaagttgtgaaagatggaatggaattttcttctagtataagaagaatg |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
32340849 |
agatgaatatagatattacaatgctggaaatataaggtttgagataactgaagaagttgtgaaagatggaatagaattttcttctagtataagaagaatg |
32340750 |
T |
|
| Q |
114 |
atagattattttgatttagttatggttgggaggggacatcctcaatctgttttgttacatggacatgatcaatggagtgagt |
195 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32340749 |
atagattattttgatttagttatggttgggaggggacatcctcaatctgttttgttacatggacatgatcaatggagtgagt |
32340668 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University