View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10126_low_17 (Length: 268)
Name: NF10126_low_17
Description: NF10126
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10126_low_17 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 201; Significance: 1e-110; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 15 - 261
Target Start/End: Complemental strand, 7360675 - 7360430
Alignment:
| Q |
15 |
caatttcatggatttccagtgttatgctaatatttgctattttcataagcaagaggctttaagtttgagatactaaaaacaatacacatcttttattgta |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7360675 |
caatttcatggatttccagtgttatgctaatatttgctattttcataagcaagaggctttaagtttgagatactaaaaacaatacacatcttttattgta |
7360576 |
T |
 |
| Q |
115 |
actcatatgccactctatttttcttactcgtttgcagtgcatgcataaattaaaattcnnnnnnngtcttggtgaaaaggataagtcgtgaaaataaggc |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| ||||||| |||||||||||||||| |||||||||| |
|
|
| T |
7360575 |
actcatatgccactctatttttcttactcgtttgcaatgcatgcataaattaaaattc-ttttttgtcttggggaaaaggataagtcgttaaaataaggc |
7360477 |
T |
 |
| Q |
215 |
gcattttttgttgcatatctctatatgtagagcaagtcggtcctttg |
261 |
Q |
| |
|
| |||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
7360476 |
gtattttttgttgcatatctctatatgtagagcaagtcggtcttttg |
7360430 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University