View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10126_low_20 (Length: 211)
Name: NF10126_low_20
Description: NF10126
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10126_low_20 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 51; Significance: 2e-20; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 105 - 163
Target Start/End: Complemental strand, 2335501 - 2335443
Alignment:
| Q |
105 |
gaaaaattcctacgaaaaaacctaatagaatggataaactaaatattaattcaagcttc |
163 |
Q |
| |
|
|||||||||||| ||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
2335501 |
gaaaaattcctaagaaaaaacctattagaatggataaactaaatattaattcaagcttc |
2335443 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University