View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10126_low_20 (Length: 211)

Name: NF10126_low_20
Description: NF10126
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10126_low_20
NF10126_low_20
[»] chr7 (1 HSPs)
chr7 (105-163)||(2335443-2335501)


Alignment Details
Target: chr7 (Bit Score: 51; Significance: 2e-20; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 105 - 163
Target Start/End: Complemental strand, 2335501 - 2335443
Alignment:
105 gaaaaattcctacgaaaaaacctaatagaatggataaactaaatattaattcaagcttc 163  Q
    |||||||||||| ||||||||||| ||||||||||||||||||||||||||||||||||    
2335501 gaaaaattcctaagaaaaaacctattagaatggataaactaaatattaattcaagcttc 2335443  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University