View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10126_low_3 (Length: 465)
Name: NF10126_low_3
Description: NF10126
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10126_low_3 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 288; Significance: 1e-161; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 288; E-Value: 1e-161
Query Start/End: Original strand, 1 - 317
Target Start/End: Original strand, 34024950 - 34025266
Alignment:
| Q |
1 |
agtgatagtgatgaatgagtgtgaatagtgggtatgtgaggtttatatagaaaaaagggtgagggtagttttgtaatttgggatttgatgatttgatact |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34024950 |
agtgatagtgatgaatgagtgtgaatagtgggtatgtgaggtttatatagaaaaaagggtgagggtagttttgtaatttgggatttgatgatttgatact |
34025049 |
T |
 |
| Q |
101 |
gtgtgtgatttgagattggggaggtggaaatggataaggaggacggtggggggagattgtatgcggtaaggtgcacgtaatgttatcgtgaaaactgaat |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34025050 |
gtgtgtgatttgagattggggaggtggaaatggataaggaggacggtgggggaagattgtatgcggtaaggtgcacgtaatgttatcgtgaaaactgaat |
34025149 |
T |
 |
| Q |
201 |
gttaccacactgtaannnnnnnagaatcacggtggtggcccactagagctatatcttcagcaacaatgcttgcttcttcttactcgttctacttcccaac |
300 |
Q |
| |
|
||||| ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34025150 |
gttactacactgtaatttttttagaatcacggtggtggcccactagagctatatcttcagcaacaatgcttgcttcttcttactcgttctacttcccaac |
34025249 |
T |
 |
| Q |
301 |
cgtggaagttcaatttc |
317 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
34025250 |
cgtggaagttcaatttc |
34025266 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 82; E-Value: 2e-38
Query Start/End: Original strand, 362 - 447
Target Start/End: Original strand, 34025314 - 34025399
Alignment:
| Q |
362 |
tgttaggattaggttgcttaaacctgaatcgattatctcattttcattctccaccttctcttcaaccttcacgttctggtcagctt |
447 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34025314 |
tgttagggttaggttgcttaaacctgaatcgattatctcattttcattctccaccttctcttcaaccttcacgttctggtcagctt |
34025399 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 58; Significance: 3e-24; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 58; E-Value: 3e-24
Query Start/End: Original strand, 362 - 447
Target Start/End: Original strand, 8790957 - 8791042
Alignment:
| Q |
362 |
tgttaggattaggttgcttaaacctgaatcgattatctcattttcattctccaccttctcttcaaccttcacgttctggtcagctt |
447 |
Q |
| |
|
||||||| ||||| ||||||||||||||| ||||||||||||| |||||| ||||||||||||||||||||||| |||||||||| |
|
|
| T |
8790957 |
tgttagggttaggatgcttaaacctgaatggattatctcatttaaattctcaaccttctcttcaaccttcacgttgtggtcagctt |
8791042 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University