View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10127_high_2 (Length: 383)
Name: NF10127_high_2
Description: NF10127
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10127_high_2 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 121; Significance: 7e-62; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 121; E-Value: 7e-62
Query Start/End: Original strand, 19 - 180
Target Start/End: Original strand, 11902153 - 11902316
Alignment:
| Q |
19 |
gaagcataggctcggaaaccgaagctcttccatagcaaatattacataggtcgattttcccgctcat--acacactgtcgctttcgctttttcgattgaa |
116 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| ||||||||||||||||||||| ||||||||| |
|
|
| T |
11902153 |
gaagcacaggctcggaaaccgaagctcttccatagcaaacattacataggtcgattttcccgctcatacacacactgtcgctttcgctttgtcgattgaa |
11902252 |
T |
 |
| Q |
117 |
aagacagacagagagatagaaagagaaaatgtt--gtcaatactctgaaaccgaacaacactgaac |
180 |
Q |
| |
|
||||||| |||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
11902253 |
aagacag--agagagatagaaagagaaaatgttgcgtcaatactctgaaaccgaacaacactgaac |
11902316 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 247 - 329
Target Start/End: Original strand, 11902380 - 11902464
Alignment:
| Q |
247 |
gattacaataatggctaggtcactttactttcttgnnnnnnnnnn--cttactttctgaaaacccattttttgctgtgtattttt |
329 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||| ||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
11902380 |
gatttcaataatggctaggtcactttactttcttgtgttttttttttctttctttctgaaaacccattttttgctgtgtattttt |
11902464 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University