View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10127_low_10 (Length: 257)
Name: NF10127_low_10
Description: NF10127
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10127_low_10 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 173; Significance: 4e-93; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 173; E-Value: 4e-93
Query Start/End: Original strand, 67 - 247
Target Start/End: Complemental strand, 34607581 - 34607401
Alignment:
| Q |
67 |
acacactttatgattaatttgtgtgtggttggttgaattgtagggaagatatacaaggatgcaggtgcatcatctggtgagctattggtacttgcactag |
166 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
34607581 |
acacactttatgattaatttgtgtgtggttggttgaattgtagggaagatatacaaggatgcaggtgcatcatctggtgagctattggtacttgcaatag |
34607482 |
T |
|
| Q |
167 |
ctcatgcattttcactatttgcagctatatcatctagcatgcatgtatctggtggacatataaaccctgctgttacctttg |
247 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
34607481 |
ctcatgcattttcactatttgcagctatatcatctagcatgcatgtatctggtggacatataaaccctgctgttacttttg |
34607401 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 32; Significance: 0.000000006; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 158 - 221
Target Start/End: Original strand, 24832853 - 24832916
Alignment:
| Q |
158 |
ttgcactagctcatgcattttcactatttgcagctatatcatctagcatgcatgtatctggtgg |
221 |
Q |
| |
|
|||||||||| ||||||||| | |||||||| ||| | || || |||||||||||||||||||| |
|
|
| T |
24832853 |
ttgcactagcacatgcatttgctctatttgctgctgtgtcttccagcatgcatgtatctggtgg |
24832916 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University