View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10127_low_14 (Length: 238)
Name: NF10127_low_14
Description: NF10127
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10127_low_14 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 182; Significance: 2e-98; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 182; E-Value: 2e-98
Query Start/End: Original strand, 14 - 223
Target Start/End: Original strand, 32826778 - 32826987
Alignment:
| Q |
14 |
cataggatggaaaaaataatggcttcaaattttaatgagcaagttattaagaaaaagtatgtaacacttttttctttgtttcttaattattttggaagac |
113 |
Q |
| |
|
||||| ||||||||| |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32826778 |
catagaatggaaaaagtaatggcttcaaattttaattagcaagttattaagaaaaagtatgtaacacttttttctttgtttcttaattattttggaagat |
32826877 |
T |
|
| Q |
114 |
ataatacttatttttatactattttctacctatatttcttccaaagaaaattaaaatagaagaattgtttaaatacaaatatatttgctttgggctttta |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| ||| ||||||||||| |
|
|
| T |
32826878 |
ataatacttatttttatactattttctacctatatttctttcaaagaaaattaaaatagaagaattgtttaaatacaaatatatatgccttgggctttta |
32826977 |
T |
|
| Q |
214 |
tctatcaagt |
223 |
Q |
| |
|
|||||||||| |
|
|
| T |
32826978 |
tctatcaagt |
32826987 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University