View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10127_low_15 (Length: 222)
Name: NF10127_low_15
Description: NF10127
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10127_low_15 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 214; Significance: 1e-117; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 1 - 222
Target Start/End: Original strand, 29065544 - 29065765
Alignment:
| Q |
1 |
ttagcttagggggccaagaatactaatagcatctcaacatgaaattgatttcaagtctgtagcagattgttcacaaagggaaaaggttgatgcctacttt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
29065544 |
ttagcttagggggccaagaatactaataccatctcaacatgaaattgatttcaagtctgtagcagattgttctcaaagggaaaaggttgatgcctacttt |
29065643 |
T |
|
| Q |
101 |
tttatcaccaatctgctaattcttcctttaagtcgagcagatcactcctattgccattcttactataagcgactgacctttttcatgctggctttgtatg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29065644 |
tttatcaccaatctgctaattcttcctttaagtcgagcagatcactcctattgccattcttactataagcgactgacctttttcatgctggctttgtatg |
29065743 |
T |
|
| Q |
201 |
ggttgccattaggggttcccac |
222 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
29065744 |
ggttgccattaggggttcccac |
29065765 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University