View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10127_low_6 (Length: 325)
Name: NF10127_low_6
Description: NF10127
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10127_low_6 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 243; Significance: 1e-135; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 243; E-Value: 1e-135
Query Start/End: Original strand, 19 - 322
Target Start/End: Original strand, 27307153 - 27307453
Alignment:
| Q |
19 |
atagtattagatactatggaacccgtttattaatgtggggtcgaattttcattttatatatccaatttgggctatcatattcagtagnnnnnnnttaaaa |
118 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| | |||||| |
|
|
| T |
27307153 |
atagcattagatactatggaacccgtttattaatgtggggtcacattttcattttatatatccaatttgggctatcatattcagttgaaaaaaattaaaa |
27307252 |
T |
 |
| Q |
119 |
ggaaattagttattcaagatttttattat-gaattattgatatatattcatttaattaccaactttctttttgttttcttctgaataatccaaatatatg |
217 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27307253 |
ggaaattagttattcaagatttttattattgaattattgatat----tcatttaattaccaactttctttttgttttcttctgaataatccaaatatatg |
27307348 |
T |
 |
| Q |
218 |
tttttggtggggaaggactaatatgacaaactataggcagttttaatcatatagtacacatttgtaagcttagttcatttcaacaaccattcaattcttc |
317 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27307349 |
tttttggtggggaaggactaatatgacaaactataggcagttttaatcatatagtacacatttgtaagcttagttcatttcaacaaccattcaattcttc |
27307448 |
T |
 |
| Q |
318 |
ttcta |
322 |
Q |
| |
|
||||| |
|
|
| T |
27307449 |
ttcta |
27307453 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University