View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10127_low_9 (Length: 291)
Name: NF10127_low_9
Description: NF10127
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF10127_low_9 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 110; Significance: 2e-55; HSPs: 4)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 110; E-Value: 2e-55
Query Start/End: Original strand, 103 - 220
Target Start/End: Original strand, 43226208 - 43226325
Alignment:
Q |
103 |
atattcctttggttttgaccaaaaacataacaactctcgaattacctcttttgatggagaagaagctaccccgcttattcaaaacaaagaccgaacatgg |
202 |
Q |
|
|
||||||||||||||||||||||||| |||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
43226208 |
atattcctttggttttgaccaaaaatataacaactctcaaattacctcttttgatggagaagaagctaccccgcttattcaaaacaaagaccgaacatgg |
43226307 |
T |
 |
Q |
203 |
cactcatagttttcttaa |
220 |
Q |
|
|
|||||||||||||||||| |
|
|
T |
43226308 |
cactcatagttttcttaa |
43226325 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 69; E-Value: 5e-31
Query Start/End: Original strand, 135 - 243
Target Start/End: Original strand, 43242008 - 43242116
Alignment:
Q |
135 |
actctcgaattacctcttttgatggagaagaagctaccccgcttattcaaaacaaagaccgaacatggcactcatagttttcttaatacttattctaaag |
234 |
Q |
|
|
|||||| ||||||||||||||||| ||||||||||| |||||||||||||||||||||||| ||||| || |||| |||||||| |||||||||||||| |
|
|
T |
43242008 |
actctcaaattacctcttttgatgcagaagaagctatcccgcttattcaaaacaaagaccggacatgacatccataattttcttattacttattctaaag |
43242107 |
T |
 |
Q |
235 |
aacagtgtt |
243 |
Q |
|
|
|||| |||| |
|
|
T |
43242108 |
aacaatgtt |
43242116 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 45 - 104
Target Start/End: Original strand, 43226065 - 43226124
Alignment:
Q |
45 |
ctagtacaagtgtttcgtatctaaatcaaattatgaaaccactaatttaaaggtaaggat |
104 |
Q |
|
|
|||||| ||||||||||||||||||||||||||||||| |||||| |||||||||||||| |
|
|
T |
43226065 |
ctagtaaaagtgtttcgtatctaaatcaaattatgaaagcactaaattaaaggtaaggat |
43226124 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 232 - 270
Target Start/End: Original strand, 43226324 - 43226362
Alignment:
Q |
232 |
aagaacagtgtttcctgagagaataacagctctgcgcaa |
270 |
Q |
|
|
||||||||||||| |||||||||||||||||||||||| |
|
|
T |
43226324 |
aagaacagtgttttatgagagaataacagctctgcgcaa |
43226362 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University