View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10128_low_6 (Length: 259)
Name: NF10128_low_6
Description: NF10128
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10128_low_6 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 19 - 247
Target Start/End: Original strand, 34641824 - 34642052
Alignment:
| Q |
19 |
gcatagtcacgtattttatgtttggtggatgatgttccgtgacatatcaccagcaactcaaatttgacgactcggggtgtaatctttttagaagctcgtt |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||| ||||||||||||||||||||||||| | |||||||| |||||||||||||| |
|
|
| T |
34641824 |
gcatagtcacgtattttatgtttggtggatgatgttccgtgacagatcgccagcaactcaaatttgacgactcgagatgtaatctctttagaagctcgtt |
34641923 |
T |
|
| Q |
119 |
tttgtttgtctaggtggacatgtggagaacgattaacatttatttttatcgtgcagcaccttcgactttctttggttgttagtgcggttttggattggtt |
218 |
Q |
| |
|
||||| |||||||||||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
34641924 |
tttgtgtgtctaggtggacaggtggagaacgattaacatttatttttatcctgcagcaccttcgactttctttggttgttagtgcggtcttggattggtt |
34642023 |
T |
|
| Q |
219 |
tcttgagggcggatattcagattatttca |
247 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
34642024 |
tcttgagggcggatattcagattatttca |
34642052 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University