View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10129_high_22 (Length: 260)
Name: NF10129_high_22
Description: NF10129
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10129_high_22 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 213; Significance: 1e-117; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 26 - 246
Target Start/End: Original strand, 47491265 - 47491485
Alignment:
| Q |
26 |
tatatatatggagtttggtttggtcctttattttatgtgagatgcgaacagagtttatttatgcatgaagacaaaaatagacagagagacatagaagagg |
125 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47491265 |
tatatatatggagtttggtttggtcttttattttatgtgagatgtgaacagagtttatttatgcatgaagacaaaaatagacagagagacatagaagagg |
47491364 |
T |
 |
| Q |
126 |
aagcaaacggagtttgtgtctttattgtcttcagaaacagacaatctcaatcgacttgattgccatgcataactgaaacatataccccgtcacagtaact |
225 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47491365 |
aagcaaacggagtttgtgtctttattgtcttcagaaacagacaatctcaatcgacttgattgccatgcataactgaaacatataccccgtcacagtaact |
47491464 |
T |
 |
| Q |
226 |
actttattacttttttacctt |
246 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
47491465 |
actttattacttttttacctt |
47491485 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University