View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10129_high_29 (Length: 249)
Name: NF10129_high_29
Description: NF10129
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10129_high_29 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 98; Significance: 2e-48; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 98; E-Value: 2e-48
Query Start/End: Original strand, 117 - 239
Target Start/End: Complemental strand, 34871045 - 34870927
Alignment:
| Q |
117 |
tttctgactcttacaaaaaaccaaatggtcgaagaatatatactaatagaaagcttcccatttcagtaaccaaagcatctcattcgtcttgttcataaat |
216 |
Q |
| |
|
||||||||||||| |||||| ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34871045 |
tttctgactcttataaaaaagcaaatggtcgaagaata----ctaatagaaagcttcccatttcagtaaccaaagcatctcattcgtcttgttcataaat |
34870950 |
T |
 |
| Q |
217 |
aaggtaatctttgcggccttctt |
239 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
34870949 |
aaggtaatctttgcggccttctt |
34870927 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 1 - 50
Target Start/End: Complemental strand, 34871161 - 34871112
Alignment:
| Q |
1 |
aaacccgcacaaacactcatagatgacgactagtgttcaaatattgcttg |
50 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34871161 |
aaacccgcacaaacactcatagatgacgactagtgttcaaatattgcttg |
34871112 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University