View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10129_high_5 (Length: 451)
Name: NF10129_high_5
Description: NF10129
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10129_high_5 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 276; Significance: 1e-154; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 276; E-Value: 1e-154
Query Start/End: Original strand, 18 - 349
Target Start/End: Original strand, 28883894 - 28884226
Alignment:
| Q |
18 |
actagtaccactaataccaggggcggatccagtgcatgacgagtgtgtgcatctgcataccctgaactttgaaaaattgcactaatattcttatagtttt |
117 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||||||| |||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
28883894 |
actagtaccactactaccaggggcggatccagtgcatgacgagtgtgtgcacgtgcataccctaaactttgaaaaattgcactaatattcttatagtttt |
28883993 |
T |
 |
| Q |
118 |
gcattatgaccac-atgaannnnnnngctttgcacctttgacccaaagagtttgcatctaaaccccaaatatccttccattgctttaatttattatttct |
216 |
Q |
| |
|
||||||||||||| ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28883994 |
gcattatgaccaccatgaatttttttgctttgcacctttgacccaaagagtttgcatctaaaccccaaatatccttccattgctttaatttattatttct |
28884093 |
T |
 |
| Q |
217 |
gccacaccgacttttcttcccttctttacttttaagcaccgatcaaatcatacagttttctgaccatatgaaggtaccaagggatccgacccatgaatgc |
316 |
Q |
| |
|
| ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
28884094 |
gtcacaccgacttttcttcccttctttacttttcagcaccgatcaaatcatacagttttctgaccatatgaaggtaccaagggatccaacccatgaatgc |
28884193 |
T |
 |
| Q |
317 |
tcccaacctgtttaaaaagatatgctgcttggc |
349 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
28884194 |
tcccaacctgtttaaaaagatatgctgcttggc |
28884226 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 409 - 440
Target Start/End: Original strand, 28884283 - 28884314
Alignment:
| Q |
409 |
gtactgtgctacaccactttgaactacttcat |
440 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
28884283 |
gtactgtgctacaccactttgaactacttcat |
28884314 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 48; Significance: 3e-18; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 35 - 130
Target Start/End: Complemental strand, 8456709 - 8456614
Alignment:
| Q |
35 |
caggggcggatccagtgcatgacgagtgtgtgcatctgcataccctgaactttgaaaaattgcactaatattcttatagttttgcattatgaccac |
130 |
Q |
| |
|
||||||||||||||||| || | ||| ||||||| ||||| |||||||||||||||||||| ||| ||||| || ||| ||||||||| ||||||| |
|
|
| T |
8456709 |
caggggcggatccagtgtatcatgagggtgtgcacctgcacaccctgaactttgaaaaattacacaaatatcctcatacttttgcattttgaccac |
8456614 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 33; Significance: 0.000000003; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 63 - 111
Target Start/End: Complemental strand, 12024865 - 12024817
Alignment:
| Q |
63 |
tgtgcatctgcataccctgaactttgaaaaattgcactaatattcttat |
111 |
Q |
| |
|
|||||||||||| ||||| |||||||||||||||||| ||||| ||||| |
|
|
| T |
12024865 |
tgtgcatctgcacaccctcaactttgaaaaattgcaccaatatccttat |
12024817 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University