View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10129_low_100 (Length: 240)
Name: NF10129_low_100
Description: NF10129
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF10129_low_100 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 221; Significance: 1e-122; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 221; E-Value: 1e-122
Query Start/End: Original strand, 1 - 229
Target Start/End: Original strand, 35364475 - 35364703
Alignment:
Q |
1 |
ctcattggagccattcatgatttgttggactatgattctgcaagctttttcagatggatggattgaatcccaaaatgcatagaggtctcgattttggcac |
100 |
Q |
|
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
35364475 |
ctcattggagccattcaagatttgttggactatgattctgcaagctttttcagatggatggattgaatcccaaaatgcatagaggtctcgattttggcac |
35364574 |
T |
 |
Q |
101 |
aagtttgcaagaggtgtgcataatttaatcccattgtatgggccatactcacaacaagctttctttgatgtaacaaatcctgttcaccaataattcgttg |
200 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
35364575 |
aagtttgcaagaggtgtgcataatttaatcccattgtatgggccatactcacaacaagctttctttgatgtaacaaatcctgttcaccaataattcgttg |
35364674 |
T |
 |
Q |
201 |
taagttagaaaataattacgaaacccttt |
229 |
Q |
|
|
|||||||||||||||||| |||||||||| |
|
|
T |
35364675 |
taagttagaaaataattatgaaacccttt |
35364703 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 108; E-Value: 2e-54
Query Start/End: Original strand, 1 - 184
Target Start/End: Original strand, 35376239 - 35376422
Alignment:
Q |
1 |
ctcattggagccattcatgatttgttggactatgattctgcaagctttttcagatggatggattgaatcccaaaatgcatagaggtctcgattttggcac |
100 |
Q |
|
|
||||||||||||| ||| ||| ||||| ||||||||||||| |||||||||||||||||||| || ||||||||||||||| |||||||||||||||||| |
|
|
T |
35376239 |
ctcattggagccagtcaagatctgttgcactatgattctgctagctttttcagatggatggaatggatcccaaaatgcataaaggtctcgattttggcac |
35376338 |
T |
 |
Q |
101 |
aagtttgcaagaggtgtgcataatttaatcccattgtatgggccatactcacaacaagctttctttgatgtaacaaatcctgtt |
184 |
Q |
|
|
||||||| ||| |||||||||| | |||||||||||| ||||| | ||||||||||| ||||||||||||||||||||||| |
|
|
T |
35376339 |
aagtttgaaaggggtgtgcatagtccaatcccattgtaagggccttgtccacaacaagctatctttgatgtaacaaatcctgtt |
35376422 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 23 - 184
Target Start/End: Original strand, 35357706 - 35357867
Alignment:
Q |
23 |
tgttggactatgattctgcaagctttttcagatggatggattgaatcccaaaatgcatagaggtctcgattttggcacaagtttgcaagaggtgtgcata |
122 |
Q |
|
|
||||||||||||||||||| |||||||||||||||||| | || ||||||||||||||| |||| ||||||| ||||||| |||| || |||||| || | |
|
|
T |
35357706 |
tgttggactatgattctgctagctttttcagatggatgaaatgcatcccaaaatgcataaaggtttcgatttgggcacaattttgaaataggtgtacaca |
35357805 |
T |
 |
Q |
123 |
atttaatcccattgtatgggccatactcacaacaagctttctttgatgtaacaaatcctgtt |
184 |
Q |
|
|
| |||||| ||| || | || | |||||||||| | ||||| |||||||||||||||| |
|
|
T |
35357806 |
gtccaatcccgttgaatcgcccttgaccacaacaagcatcctttgctgtaacaaatcctgtt |
35357867 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University