View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10129_low_101 (Length: 239)
Name: NF10129_low_101
Description: NF10129
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10129_low_101 |
 |  |
|
| [»] scaffold0041 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr8 (Bit Score: 230; Significance: 1e-127; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 230; E-Value: 1e-127
Query Start/End: Original strand, 1 - 230
Target Start/End: Original strand, 29002720 - 29002949
Alignment:
| Q |
1 |
ttttgggtatttaaggtacctatggtattcttcccctctttgcaatggttttagtctctttatttagacaaaatcataatttggtctccatattttcaat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29002720 |
ttttgggtatttaaggtacctatggtattcttcccctctttgcaatggttttagtctctttatttagacaaaatcataatttggtctccatattttcaat |
29002819 |
T |
 |
| Q |
101 |
tgcgcaattttggtcccccatttcaattttgtatgaatcatgactttgatcatcctatttgatgatgtggtcgtaaattattcactttcagccccatgta |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29002820 |
tgcgcaattttggtcccccatttcaattttgtatgaatcatgactttgatcatcctatttgatgatgtggtcgtaaattattcactttcagccccatgta |
29002919 |
T |
 |
| Q |
201 |
tcgttttaattgatcatcttttgcctttgc |
230 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
29002920 |
tcgttttaattgatcatcttttgcctttgc |
29002949 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0041 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: scaffold0041
Description:
Target: scaffold0041; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 157 - 225
Target Start/End: Original strand, 84369 - 84437
Alignment:
| Q |
157 |
atttgatgatgtggtcgtaaattattcactttcagccccatgtatcgttttaattgatcatcttttgcc |
225 |
Q |
| |
|
|||||||||| |||| ||||||||||| ||||| || |||||| |||||||||||| ||||||||| |
|
|
| T |
84369 |
atttgatgatatggtagtaaattattccctttcttttccttgtatcattttaattgatcttcttttgcc |
84437 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 157 - 225
Target Start/End: Complemental strand, 40881914 - 40881846
Alignment:
| Q |
157 |
atttgatgatgtggtcgtaaattattcactttcagccccatgtatcgttttaattgatcatcttttgcc |
225 |
Q |
| |
|
|||||||||| |||| ||||||||||| ||||| || |||||| |||||||||||| ||||||||| |
|
|
| T |
40881914 |
atttgatgatatggtagtaaattattccctttcttttccttgtatcattttaattgatcttcttttgcc |
40881846 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University