View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10129_low_102 (Length: 238)
Name: NF10129_low_102
Description: NF10129
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10129_low_102 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 201; Significance: 1e-110; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 1 - 220
Target Start/End: Complemental strand, 11173451 - 11173231
Alignment:
| Q |
1 |
cagtaatcattctgtcatattgcatcatgtactttggtctgaaaaatcactgactcattggtctcagtcagacaagtaagatagcatagccataaggccc |
100 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
11173451 |
cagtaatcattctatcatattgcatcatgtactttggtctgaaaaatcactgactcattggtctcagtcagacaagtaagataacatagccataaggccc |
11173352 |
T |
|
| Q |
101 |
gagtgagtgggtctctctctgaaaaatcagtgttatctg-catatccctgctacttttgcacccatatttggaaagtgaattaatataaaaaatgaaaag |
199 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11173351 |
gagtgagtgggtctctctctgaaaaatcagtgttatctgccatatccttgctacttttgcacccatatttggaaagtgaattaatataaaaaatgaaaag |
11173252 |
T |
|
| Q |
200 |
ttttgtatgagttattgtatt |
220 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
11173251 |
ttttgtatgagttattgtatt |
11173231 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 77; E-Value: 7e-36
Query Start/End: Original strand, 1 - 116
Target Start/End: Original strand, 11150195 - 11150311
Alignment:
| Q |
1 |
cagtaatcattctgtcatattgcatcatgtactttggtctgaaaaatcactgactcattggtctcagtcagacaagtaagatagcatagccataa-ggcc |
99 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||| |||||||||||||||||||||||||| ||||||||||||||||| ||||||| || |
|
|
| T |
11150195 |
cagtaatcattctgtcatattgagtcatgtactttggtctgagaaatcactgactcattggtctcagtccgacaagtaagatagcatggccataatgggg |
11150294 |
T |
|
| Q |
100 |
cgagtgagtgggtctct |
116 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
11150295 |
agagtgagtgggtctct |
11150311 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University