View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10129_low_103 (Length: 237)
Name: NF10129_low_103
Description: NF10129
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10129_low_103 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 134; Significance: 7e-70; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 134; E-Value: 7e-70
Query Start/End: Original strand, 60 - 225
Target Start/End: Complemental strand, 30959230 - 30959064
Alignment:
| Q |
60 |
attgtgcatgtcttaagatatttgacatgattattgtattggttatcttatcttgctattgcactgtccttaattagttgaaaatataagctaagtaagt |
159 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
30959230 |
attgtgcatgtcttaagatatttgacatgattattgtattggttatcttatcttgctattgcactgtcctta----gttgaaaatataagctaagtaagt |
30959135 |
T |
 |
| Q |
160 |
attaaataattttgatgacgatatgttgaatatcctacatgtc-----atgtgatataagtgttgaatctg |
225 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
30959134 |
attaaataattttgatgacgatatgttgaatatcctacatgtcatgtcatgtgatataagtgttgaatctg |
30959064 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 1 - 55
Target Start/End: Complemental strand, 30959479 - 30959421
Alignment:
| Q |
1 |
gtcatatgcaagttgtgtttatacacc----atgtttatcatgagagaaacaaccactt |
55 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
30959479 |
gtcatatgcaagttgtgtttatacaccatgtatgtttatcatgagagaaacaaccactt |
30959421 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University