View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10129_low_108 (Length: 230)
Name: NF10129_low_108
Description: NF10129
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF10129_low_108 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 136; Significance: 4e-71; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 136; E-Value: 4e-71
Query Start/End: Original strand, 38 - 196
Target Start/End: Complemental strand, 4700297 - 4700138
Alignment:
Q |
38 |
cgatagtagtttagggaatgacaactttagtttttacggtaagtttaagtaatcctcac-taattggtttgtaaagtatgatgttcacttcttataacat |
136 |
Q |
|
|
|||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |||||||||||||||||||||| ||||||||||||||||| |
|
|
T |
4700297 |
cgatagtagtttagggaatgacaactttagtttttatattaagtttaagtaatcctcacataattggtttgtaaagtatgattttcacttcttataacat |
4700198 |
T |
 |
Q |
137 |
atatttagacattatcatatgtaacaaccaatttcaaatgatacaattacatactatatg |
196 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
4700197 |
atatttagacattatcatatgtaacaaccaatttcaaatgatacaattacatactatatg |
4700138 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 97 - 192
Target Start/End: Complemental strand, 4818261 - 4818170
Alignment:
Q |
97 |
taattggtttgtaaagtatgatgttcacttcttataacatatatttagacattatcatatgtaacaaccaatttcaaatgatacaattacatacta |
192 |
Q |
|
|
|||||||||| ||||||||||| ||||||| |||||| |||||| || || | || |||||||||||||||||||||||||||||| |||| |
|
|
T |
4818261 |
taattggtttataaagtatgattttcactttttataatatatatata----tttagacatataacaaccaatttcaaatgatacaattacacacta |
4818170 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University