View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10129_low_110 (Length: 229)
Name: NF10129_low_110
Description: NF10129
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10129_low_110 |
 |  |
|
| [»] scaffold0016 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr8 (Bit Score: 101; Significance: 3e-50; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 101; E-Value: 3e-50
Query Start/End: Original strand, 115 - 227
Target Start/End: Complemental strand, 42066947 - 42066835
Alignment:
| Q |
115 |
gttgatattcctctgttataggacagagaatgagaacccccaaagaatattaaatagagaaaatagacttaattttattgatgattgtaatagagaaagt |
214 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42066947 |
gttgatattcctctgttataggacagataatgagaaccccctaagaatattaaatagagaaaatagacttaattttattgatgattgtaatagagaaagt |
42066848 |
T |
 |
| Q |
215 |
accattgatgatt |
227 |
Q |
| |
|
| ||||||||||| |
|
|
| T |
42066847 |
atcattgatgatt |
42066835 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 57; E-Value: 6e-24
Query Start/End: Original strand, 11 - 75
Target Start/End: Complemental strand, 42067060 - 42066996
Alignment:
| Q |
11 |
ttctacatttggccaatgcttttgtgaatacgaatgtatctaatggatcaatatcgatggtaaga |
75 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |||||||| |
|
|
| T |
42067060 |
ttctacatttggccaatgcttttgtgaatacgaaggtatctaatggatcaatatcggtggtaaga |
42066996 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 36; Significance: 0.00000000002; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 177 - 216
Target Start/End: Complemental strand, 15831805 - 15831766
Alignment:
| Q |
177 |
atagacttaattttattgatgattgtaatagagaaagtac |
216 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
15831805 |
atagacttaattttattgatgattgaaatagagaaagtac |
15831766 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0016 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: scaffold0016
Description:
Target: scaffold0016; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 125 - 162
Target Start/End: Original strand, 6473 - 6510
Alignment:
| Q |
125 |
ctctgttataggacagagaatgagaacccccaaagaat |
162 |
Q |
| |
|
|||||||||||||||||||||||||||| || |||||| |
|
|
| T |
6473 |
ctctgttataggacagagaatgagaacctcctaagaat |
6510 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 125 - 162
Target Start/End: Complemental strand, 23385995 - 23385958
Alignment:
| Q |
125 |
ctctgttataggacagagaatgagaacccccaaagaat |
162 |
Q |
| |
|
|||||||||||||||||||||||||||| || |||||| |
|
|
| T |
23385995 |
ctctgttataggacagagaatgagaacctcctaagaat |
23385958 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University