View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10129_low_111 (Length: 229)
Name: NF10129_low_111
Description: NF10129
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10129_low_111 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 195; Significance: 1e-106; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 6 - 229
Target Start/End: Original strand, 34386096 - 34386319
Alignment:
| Q |
6 |
acaaagtgcagtttcctgtttgctatattctgtgaaaacaaacaagctgtttttgtttttcaagagtttctaagacataatcatgtatctttcccgacaa |
105 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
34386096 |
acaaagtgcagtttcctgtttgctatattctgtgaaaacaaacaagctgtttttgtttttcaagagtttctaagacataatcatgaatctttcccgacaa |
34386195 |
T |
 |
| Q |
106 |
tttcagaaaggaagggacaataattttcaaacataacttttattctgcatagacaaataaagcataatactatcctgttttcnnnnnnngattacatcat |
205 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
34386196 |
tttcagaaaggaagggacaataattttcaaacataacttttattctgcatagacaaataaagcataatactatcctgttttctttttttgattacatcat |
34386295 |
T |
 |
| Q |
206 |
ctaacgtgaagtactgttttattt |
229 |
Q |
| |
|
|||||||| ||||||||||||||| |
|
|
| T |
34386296 |
ctaacgtggagtactgttttattt |
34386319 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University