View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10129_low_12 (Length: 429)
Name: NF10129_low_12
Description: NF10129
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10129_low_12 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 82; Significance: 1e-38; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 82; E-Value: 1e-38
Query Start/End: Original strand, 1 - 86
Target Start/End: Original strand, 48518401 - 48518486
Alignment:
| Q |
1 |
gggttctactaagttctaggtggagaaattcaagaacaataatgattccagtctttggagaatgaagatgaggactttcttggtta |
86 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
48518401 |
gggttctactaagttctaggtggagaaattcaagaacaataatgattccagtctttggagaatgaagatgaggattttcttggtta |
48518486 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University