View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10129_low_21 (Length: 389)
Name: NF10129_low_21
Description: NF10129
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10129_low_21 |
 |  |
|
| [»] scaffold0365 (2 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0365 (Bit Score: 292; Significance: 1e-164; HSPs: 2)
Name: scaffold0365
Description:
Target: scaffold0365; HSP #1
Raw Score: 292; E-Value: 1e-164
Query Start/End: Original strand, 24 - 379
Target Start/End: Original strand, 1938 - 2297
Alignment:
| Q |
24 |
tgctagaccaatcctcgttgtttctcgttaaatagagtagtcttccaaaatcattcaccaactcgttaacgaattaataaccatgtcaaattcttcttc- |
122 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1938 |
tgctagaccaatcctcgttgtttctcgttaaatag--tagtcttccaaaatcattcaccaactcgttaacgaattaataaccatgtcaaattcttcttct |
2035 |
T |
 |
| Q |
123 |
-----atcaagttcaagtgaatacctccaaaccctcttaacctcagctaaacccttcctccgtaacgagctcaattccattgacgccaacctcccttccc |
217 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||||||||| |||||| || |||| |||||||||| |
|
|
| T |
2036 |
tattcatcaagttcaagtgaatacctcgaaaccctcttaacctcagctaaacccttccttcgtaacgagctcatttccatcgatcccaaactcccttccc |
2135 |
T |
 |
| Q |
218 |
taatcacaatcctccgttcggttggtgcatccgaatgttggcacaaacatggaactttccttgaacaccttattgatattttccgcattctccatctttg |
317 |
Q |
| |
|
||||||||||||||||||| ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2136 |
taatcacaatcctccgttctgttggtgcatctgaatgttggcacaaacatggaactttccttgaacaccttattgatattttccgcattctccatctttg |
2235 |
T |
 |
| Q |
318 |
gaaatctccatactccgtgtctctttgtggcctattccactcagcatactccaattcctatg |
379 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2236 |
gaaatctccatactccgtgtctctttgtggcctattccactcagcatactccaattcctatg |
2297 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0365; HSP #2
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 203 - 253
Target Start/End: Original strand, 17291 - 17341
Alignment:
| Q |
203 |
ccaacctcccttccctaatcacaatcctccgttcggttggtgcatccgaat |
253 |
Q |
| |
|
||||||||||||||| ||||||| |||||||||| || ||||||||||||| |
|
|
| T |
17291 |
ccaacctcccttcccgaatcacagtcctccgttccgtaggtgcatccgaat |
17341 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 35; Significance: 0.0000000001; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 203 - 253
Target Start/End: Complemental strand, 14492793 - 14492743
Alignment:
| Q |
203 |
ccaacctcccttccctaatcacaatcctccgttcggttggtgcatccgaat |
253 |
Q |
| |
|
||||||||||||||| ||||||| |||||||||| || ||||||||||||| |
|
|
| T |
14492793 |
ccaacctcccttcccgaatcacagtcctccgttccgtaggtgcatccgaat |
14492743 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University