View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10129_low_37 (Length: 336)
Name: NF10129_low_37
Description: NF10129
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF10129_low_37 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 271; Significance: 1e-151; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 271; E-Value: 1e-151
Query Start/End: Original strand, 24 - 321
Target Start/End: Original strand, 27177783 - 27178078
Alignment:
Q |
24 |
aaccccactatatgctgccattgcaccaccatcactttcatcagtagttatattcacgttcctcccatgcagaagaatgtttcttttcctaaacaagtat |
123 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
T |
27177783 |
aaccccactatatgctgccattgcaccaccatcactttcatcagtagttat--tcacgttcctcccatgcagaagaatgtttgttttcctaaacaagtat |
27177880 |
T |
 |
Q |
124 |
actgttttcttttactatctatgaccctacacgccactcttgtttcatatttatgtataatacttgcaggacaaacttacaccagcttgcatatgttgtc |
223 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
27177881 |
actgttttcttttactatctatgaccctacacgccactcttgtttcatatttatgtataatacttgcaggacaaacttacaccagcttgcatatgttgtc |
27177980 |
T |
 |
Q |
224 |
tttttctctgttatccacttcgaatgtggcaaatcaaacttcatttctcgtgaatgaatcaatttactgttttcattcttctagttcgtttccctttg |
321 |
Q |
|
|
|||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| || ||||||||||||||||||||||||||||||||||| |
|
|
T |
27177981 |
tttttctctgatatccacttcgaatgtggcaaatcaaacttcatttctcgtgaatgaattaacttactgttttcattcttctagttcgtttccctttg |
27178078 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University