View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10129_low_44 (Length: 304)
Name: NF10129_low_44
Description: NF10129
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10129_low_44 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 179; Significance: 1e-96; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 179; E-Value: 1e-96
Query Start/End: Original strand, 4 - 248
Target Start/End: Original strand, 34871257 - 34871503
Alignment:
| Q |
4 |
agttgactgaaaatcaatattttaaaccatgtttgtttagtgtt--cgaggagaggagg-----tccatgatatc-gatactagaagaagcgtctaactt |
95 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||| ||||||||||||| ||||||||||| |||||||||||||||||||||||| |
|
|
| T |
34871257 |
agttgactgaaaatcaatattttaaaccaagtttgtttagtgttttcgaggagaggaggggttgtccatgatatctgatactagaagaagcgtctaactt |
34871356 |
T |
 |
| Q |
96 |
acctagagtttttgcaagtatgtcatgctccaagggtatgagtgatgcgaatatacatatacccatcttgatcaaaatggtctttgatatcctgaatcaa |
195 |
Q |
| |
|
||||||||||||||||| |||||||||||| ||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34871357 |
acctagagtttttgcaactatgtcatgctcgaagggtatgagtgatgcga------atatacccatcttgatcaaaatggtctttgatatcctgaatcaa |
34871450 |
T |
 |
| Q |
196 |
agtaacatacttgtacaatttgagagtctaagcttggagaatatcaacacatt |
248 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34871451 |
agtaacatacttgtacaatttgagagtctaagcttggagaatatcaacacatt |
34871503 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University