View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10129_low_45 (Length: 304)
Name: NF10129_low_45
Description: NF10129
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10129_low_45 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 169; Significance: 1e-90; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 169; E-Value: 1e-90
Query Start/End: Original strand, 1 - 219
Target Start/End: Original strand, 4599820 - 4600036
Alignment:
| Q |
1 |
aacaaaactggttcgtgagatacaccgtaagccaggatgtggagtgtgtatcttgagttggatgtggatgcatccaaaaggacaattcgtggatttaaga |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4599820 |
aacaaaactggttcgtgagatacaccgtaagccaggatgtggagtgtgtatcttgagttggatgtggatgcatccaaaaggacaattcgtggatttaaga |
4599919 |
T |
 |
| Q |
101 |
attaaccggttatttaaaag----atccacaacaataaatttttaagttgaaaaagaaagccctgaattattattatacaggagggagggggtaaacaaa |
196 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||| |||||||||||||||||||||||||||||| ||||||||| |||||||||||||||| |
|
|
| T |
4599920 |
attaaccggttatttaaaagatccatccacaacaataaa-ttttaagttgaaaaagaaagccctgaatta-tattataca----ggagggggtaaacaaa |
4600013 |
T |
 |
| Q |
197 |
gttctccttaggtgcatctaaat |
219 |
Q |
| |
|
||||||| ||||||||||||||| |
|
|
| T |
4600014 |
gttctccataggtgcatctaaat |
4600036 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University