View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10129_low_54 (Length: 281)
Name: NF10129_low_54
Description: NF10129
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10129_low_54 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 249; Significance: 1e-138; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 249; E-Value: 1e-138
Query Start/End: Original strand, 10 - 266
Target Start/End: Original strand, 27121102 - 27121358
Alignment:
| Q |
10 |
gcaaaggaagcacttgtgttgtttcgtgagtttatacgtgagggttttcgtcctgtgaatgtgatttttgttggcgttttaaatgcttgtagtagggctg |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27121102 |
gcaaaggaagcacttgtgttgtttcgtgagtttatacgtgagggttttcgtcctgtgaatgtgatttttgttggcgttttaaatgcttgtagtagggctg |
27121201 |
T |
 |
| Q |
110 |
gtttggttagtgagggaaggtattactttaagttaatggtggatagttatggaatttcgccggagatggagcactatgggtgcatggttgatctctttgc |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
27121202 |
gtttggttagtgagggaaggtattactttaagttaatggtggatggttatggaatttcgccggagatggagcactatggttgcatggttgatctctttgc |
27121301 |
T |
 |
| Q |
210 |
tcgtgcgggattaatagatgaagcagttcggttgattgaaacgatgactgttgaacc |
266 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27121302 |
tcgtgcgggattaatagatgaagcagttcggttgattgaaacgatgactgttgaacc |
27121358 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University