View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10129_low_57 (Length: 276)
Name: NF10129_low_57
Description: NF10129
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF10129_low_57 |
 |  |
|
[»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 143; Significance: 3e-75; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 143; E-Value: 3e-75
Query Start/End: Original strand, 46 - 276
Target Start/End: Original strand, 33219910 - 33220134
Alignment:
Q |
46 |
ccatcatcgtcatcatgatggatgagcttcacgatgagcctaccattttctcgattcgcttccatatgctcataataacgcttcactttccccaccttta |
145 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
33219910 |
ccatcatcgtcatcatgatggatgagcttcacgatgagcctaccattttctctattcgcttccatatgctcataataacgcttcactttccccaccttta |
33220009 |
T |
 |
Q |
146 |
aaatcaaccttccatcttcaccatattccttcttaaaacacgaaggcatnnnnnnnnnnnnnnnnnnnnnggtttctctcaacaacgttatcgccggtgg |
245 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||| ||| |||||||||||||||||||||||||| ||| |
|
|
T |
33220010 |
aaatcaaccttccatcttcaccatattccttcttaaaacacgaagacat------tcctcctcctcctccggtttctctcaacaacgttatcgccgctgg |
33220103 |
T |
 |
Q |
246 |
aaaaaccttcttctctctctgcttctccact |
276 |
Q |
|
|
|||||||||||||||||||| ||||| |||| |
|
|
T |
33220104 |
aaaaaccttcttctctctcttcttcttcact |
33220134 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University