View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10129_low_61 (Length: 270)
Name: NF10129_low_61
Description: NF10129
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10129_low_61 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 172; Significance: 2e-92; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 172; E-Value: 2e-92
Query Start/End: Original strand, 1 - 176
Target Start/End: Complemental strand, 25378734 - 25378559
Alignment:
| Q |
1 |
ccactaccttcctccaatgctgaatggaattcagaatcagaacaacgttgagttgcatcttgggaatatgaatttttcagaggggaagagagagatggat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25378734 |
ccactaccttcctccaatgctgaatggaattcagaatcagaacaacgtggagttgcatcttgggaatatgaatttttcagaggggaagagagagatggat |
25378635 |
T |
 |
| Q |
101 |
ttgttggagttggtttcttctgctcagttttattagtgctgctgctggtgattctaaaatgatgaatctatcattt |
176 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25378634 |
ttgttggagttggtttcttctgctcagttttattagtgctgctgctggtgattctaaaatgatgaatctatcattt |
25378559 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 221 - 270
Target Start/End: Complemental strand, 25378513 - 25378464
Alignment:
| Q |
221 |
cttccacgtttgataaaccatgcttccactatagcatggtagtatgcatt |
270 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25378513 |
cttccacgtttgataaaccatgcttccactatagcatggtagtatgcatt |
25378464 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University