View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10129_low_66 (Length: 263)
Name: NF10129_low_66
Description: NF10129
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10129_low_66 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 53; Significance: 2e-21; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 133 - 185
Target Start/End: Complemental strand, 9699702 - 9699650
Alignment:
| Q |
133 |
tatattaatctaacaacttctaacatttatcatttaaaaaatatatattgtca |
185 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9699702 |
tatattaatctaacaacttctaacatttatcatttaaaaaatatatattgtca |
9699650 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 52; E-Value: 7e-21
Query Start/End: Original strand, 14 - 73
Target Start/End: Complemental strand, 9699761 - 9699702
Alignment:
| Q |
14 |
ctttcatcctagaggttcttctggagaagtcgtcaattgggtgagattgctaatttgatt |
73 |
Q |
| |
|
||||||||||||||| |||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
9699761 |
ctttcatcctagaggctcttctggagaattcgtcaattgggtgagattgctaatttgatt |
9699702 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 217 - 252
Target Start/End: Complemental strand, 9699593 - 9699558
Alignment:
| Q |
217 |
tgtctgcgcccctcgattacttttttgtcctttcat |
252 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
9699593 |
tgtctgcgcccctcgattacttttttgtcctttcat |
9699558 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 53; Significance: 2e-21; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 133 - 185
Target Start/End: Complemental strand, 13566079 - 13566027
Alignment:
| Q |
133 |
tatattaatctaacaacttctaacatttatcatttaaaaaatatatattgtca |
185 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13566079 |
tatattaatctaacaacttctaacatttatcatttaaaaaatatatattgtca |
13566027 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 52; E-Value: 7e-21
Query Start/End: Original strand, 14 - 73
Target Start/End: Complemental strand, 13566138 - 13566079
Alignment:
| Q |
14 |
ctttcatcctagaggttcttctggagaagtcgtcaattgggtgagattgctaatttgatt |
73 |
Q |
| |
|
||||||||||||||| |||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
13566138 |
ctttcatcctagaggctcttctggagaattcgtcaattgggtgagattgctaatttgatt |
13566079 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 217 - 252
Target Start/End: Complemental strand, 13565970 - 13565935
Alignment:
| Q |
217 |
tgtctgcgcccctcgattacttttttgtcctttcat |
252 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
13565970 |
tgtctgcgcccctcgattacttttttgtcctttcat |
13565935 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University