View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10129_low_69 (Length: 256)
Name: NF10129_low_69
Description: NF10129
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10129_low_69 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 214; Significance: 1e-117; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 19 - 248
Target Start/End: Complemental strand, 32656952 - 32656723
Alignment:
| Q |
19 |
tccgaagcaaatactgcaatctccggcgatgctctgttctgagaggtttaggacagagacgaagaacataagaaggtcttgtaagcgataaacggattct |
118 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32656952 |
tccgcagcaaatactgcaatctccggcgatgctctgttctgagaggtttaggacatagacgaagaacataagaaggtcttgtaagcgataaacggattct |
32656853 |
T |
 |
| Q |
119 |
catctccttctttttccgggcggagagttggttgctagcatcgtcctttctcttgcggcggggggttggtttcgttggtgtaatgttggtatcggcttgt |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32656852 |
catctccttctttttccgggcggagagttggttgctagcatcgtccttcctcttgcggcggggggttggtttcgttggtgtaatgttggtatcggcttgt |
32656753 |
T |
 |
| Q |
219 |
attatatctaatgcttcgacttcctttgct |
248 |
Q |
| |
|
|||||||||||||||||||||||| ||||| |
|
|
| T |
32656752 |
attatatctaatgcttcgacttccattgct |
32656723 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University