View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10129_low_73 (Length: 253)
Name: NF10129_low_73
Description: NF10129
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10129_low_73 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 163; Significance: 4e-87; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 163; E-Value: 4e-87
Query Start/End: Original strand, 41 - 239
Target Start/End: Complemental strand, 32802634 - 32802436
Alignment:
| Q |
41 |
agtccaaagaatcattgctaacatgtcaaagggagacaatgtggttgttttggacttttgggctagtccattttgtgctagagtgaaaattgccttggaa |
140 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
32802634 |
agtccaaagaatcattgctaacatgtcaaagggagacaatgtggttgttttggacttttgggctagtccattttgtgctagagtgaaaattgctttggaa |
32802535 |
T |
 |
| Q |
141 |
gagaaagatgtacctcatgtggacaatgaagaggatttgtttggnnnnnnnngtgagcttcttttgaagtcaaaccctattcaccaaaaagtgtctgtg |
239 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
32802534 |
gagaaaggtgtacctcatgtggacaatgaagaggatttgtttggaaaaaaaagtgagcttcttttgaagtcaaaccctattcaccaaaaagtgcctgtg |
32802436 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University