View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10129_low_74 (Length: 253)
Name: NF10129_low_74
Description: NF10129
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10129_low_74 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 116; Significance: 4e-59; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 116; E-Value: 4e-59
Query Start/End: Original strand, 14 - 190
Target Start/End: Original strand, 42141452 - 42141631
Alignment:
| Q |
14 |
cataggctacggagaaaaagaaaatgggattgactatttgatttttt----gtttcattttattctcaaatatattttgatgggatagattagatgaatt |
109 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||| |||||| ||||||||||||||||||| |||||||||||||| |||| |||||||| |
|
|
| T |
42141452 |
cataggctacggagaaaaagaaaatggg-ttgactatttgttttttttttcttttcattttattctcaaatctattttgatgggatggattggatgaatt |
42141550 |
T |
 |
| Q |
110 |
ggaatattttgaacgtaaagaattgatgatgatgttgtttttgtctgcaaagtttgataattgatagtgtaactttcaaca |
190 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||| ||||||||||||| ||| ||||||||||||||| |
|
|
| T |
42141551 |
ggaatattttgaacgcaaagaattgatgatgatgttgtttttgtctacaaagtttgataactgacggtgtaactttcaaca |
42141631 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 55 - 107
Target Start/End: Original strand, 40885748 - 40885800
Alignment:
| Q |
55 |
ttttttgtttcattttattctcaaatatattttgatgggatagattagatgaa |
107 |
Q |
| |
|
|||| |||||||||||||||||||||| ||||| || |||| ||| ||||||| |
|
|
| T |
40885748 |
ttttatgtttcattttattctcaaatacattttaataggattgatcagatgaa |
40885800 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 184 - 228
Target Start/End: Original strand, 42141655 - 42141698
Alignment:
| Q |
184 |
ttcaacatattaatagttgttaatgattacatatatgaataaggt |
228 |
Q |
| |
|
||||||||||||||||||||| |||||| || ||||||||||||| |
|
|
| T |
42141655 |
ttcaacatattaatagttgtt-atgattgcacatatgaataaggt |
42141698 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 58; Significance: 2e-24; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 125 - 186
Target Start/End: Complemental strand, 25520224 - 25520163
Alignment:
| Q |
125 |
taaagaattgatgatgatgttgtttttgtctgcaaagtttgataattgatagtgtaactttc |
186 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
25520224 |
taaagaattgatgatgatgttgtttttgtctgcaaagtttgataattgatagtgtacctttc |
25520163 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 140 - 189
Target Start/End: Original strand, 7052597 - 7052646
Alignment:
| Q |
140 |
gatgttgtttttgtctgcaaagtttgataattgatagtgtaactttcaac |
189 |
Q |
| |
|
|||||||||||||||| ||||||||||||| | || | |||||||||||| |
|
|
| T |
7052597 |
gatgttgtttttgtcttcaaagtttgataaattatggggtaactttcaac |
7052646 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University