View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10129_low_75 (Length: 253)
Name: NF10129_low_75
Description: NF10129
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10129_low_75 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 238; Significance: 1e-132; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 238; E-Value: 1e-132
Query Start/End: Original strand, 12 - 253
Target Start/End: Complemental strand, 44333478 - 44333237
Alignment:
| Q |
12 |
agcaaagggattcaggaaagttcgtgaggttgaaggaggaggaacatggtggtgatgagaaagaggaagaagcttcaggatcacatggattgaaccaaca |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44333478 |
agcaaagggattcaggaaagttcgtgaggttgaaggaggaggaacatggtggtgatgagaaagaggaagaagcttcaggatcacatggattgaaccaaca |
44333379 |
T |
 |
| Q |
112 |
gcagtatggggaggtggcaatgtcttgtcctatggtttcagcgccgactcagcatggattgggccaggcccaaaatgagtgggtccaagtccaacaagga |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44333378 |
gcagtatggggaggtggcaatgtcttgtcctatggtttcagcgccgactcagcatggattgggccaggcccaaaatgagtgggtccaagtccaacaagga |
44333279 |
T |
 |
| Q |
212 |
agtggttattttccaatgatgtcaggttttgtccctgtctct |
253 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
44333278 |
agtggctattttccaatgatgtcaggttttgtccctgtctct |
44333237 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University