View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10129_low_78 (Length: 250)
Name: NF10129_low_78
Description: NF10129
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10129_low_78 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 167; Significance: 1e-89; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 167; E-Value: 1e-89
Query Start/End: Original strand, 37 - 244
Target Start/End: Original strand, 30959861 - 30960069
Alignment:
| Q |
37 |
tgtcttgcgtgattcattgtgatccaaattattcaactccgggcaatatgcatcatctcccctaaacatcatgttgnnnnnnnnnn-ttcacaaattcct |
135 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
30959861 |
tgtcttgcgtgattcattgtgatccaaattattcaactccgggcaatatgcatcatctcccctaaacatcatgttgaaagaaaaaaattcacaaattcct |
30959960 |
T |
 |
| Q |
136 |
tgaataaacaatcaaaatattagggttattgttcaaacacaaataattatagtgatgataaaacattggttgtgttgcaagtaaaattgtctttctcgct |
235 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30959961 |
tgaataaacaatcaaaatattagggttattgttcaaacacaaataattatagtgatgataaaacattggttgtgttgcaagtaaaattgtctttctcgct |
30960060 |
T |
 |
| Q |
236 |
tcttctctc |
244 |
Q |
| |
|
| ||||||| |
|
|
| T |
30960061 |
ttttctctc |
30960069 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 1 - 44
Target Start/End: Original strand, 30959806 - 30959849
Alignment:
| Q |
1 |
aaataaaccaagatgcacatctttatatataggaattgtcttgc |
44 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30959806 |
aaataaaccaagatgcacatctttatatataggaattgtcttgc |
30959849 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University