View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10129_low_85 (Length: 250)
Name: NF10129_low_85
Description: NF10129
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10129_low_85 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 208; Significance: 1e-114; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 16 - 231
Target Start/End: Original strand, 40745855 - 40746069
Alignment:
| Q |
16 |
ataacacaatctaataactctcagtctcaactagaaagaatataacaatacaaatcaaatatcaaccatagttatcactcttagagagacaatcaaacta |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40745855 |
ataacacaatctaataactctcagtctcaacta-aaagaatataacaatacaaatcaaatatcaaccatagttatcactcttagagagacaatcaaacta |
40745953 |
T |
 |
| Q |
116 |
actagatttgattgatttacaacaagatgacgagctctcaatgagaaaggatatacactgaatatctcgtgttctaggcctgattgactgcccgccttca |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40745954 |
actagatttgattgatttacaacaagatgacgagctctcaatgagaaaggatatacactgaatatctcgtgttctaggcctgattgactgcccgccttca |
40746053 |
T |
 |
| Q |
216 |
ttacagtattttcttt |
231 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
40746054 |
ttacagtattttcttt |
40746069 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University