View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10129_low_86 (Length: 249)

Name: NF10129_low_86
Description: NF10129
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10129_low_86
NF10129_low_86
[»] chr1 (2 HSPs)
chr1 (117-239)||(34870927-34871045)
chr1 (1-50)||(34871112-34871161)


Alignment Details
Target: chr1 (Bit Score: 98; Significance: 2e-48; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 98; E-Value: 2e-48
Query Start/End: Original strand, 117 - 239
Target Start/End: Complemental strand, 34871045 - 34870927
Alignment:
117 tttctgactcttacaaaaaaccaaatggtcgaagaatatatactaatagaaagcttcccatttcagtaaccaaagcatctcattcgtcttgttcataaat 216  Q
    ||||||||||||| |||||| |||||||||||||||||    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
34871045 tttctgactcttataaaaaagcaaatggtcgaagaata----ctaatagaaagcttcccatttcagtaaccaaagcatctcattcgtcttgttcataaat 34870950  T
217 aaggtaatctttgcggccttctt 239  Q
    |||||||||||||||||||||||    
34870949 aaggtaatctttgcggccttctt 34870927  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 1 - 50
Target Start/End: Complemental strand, 34871161 - 34871112
Alignment:
1 aaacccgcacaaacactcatagatgacgactagtgttcaaatattgcttg 50  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||    
34871161 aaacccgcacaaacactcatagatgacgactagtgttcaaatattgcttg 34871112  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University